When.com Web Search

Search results

  1. Results From The WOW.Com Content Network
  2. SNP array - Wikipedia

    en.wikipedia.org/wiki/SNP_array

    A single nucleotide polymorphism (SNP), a variation at a single site in DNA, is the most frequent type of variation in the genome. Around 335 million SNPs have been identified in the human genome, [1] 15 million of which are present at frequencies of 1% or higher across different populations worldwide. [2]

  3. Single-nucleotide polymorphism - Wikipedia

    en.wikipedia.org/wiki/Single-nucleotide_polymorphism

    In genetics and bioinformatics, a single-nucleotide polymorphism (SNP / s n ɪ p /; plural SNPs / s n ɪ p s /) is a germline substitution of a single nucleotide at a specific position in the genome. Although certain definitions require the substitution to be present in a sufficiently large fraction of the population (e.g. 1% or more), [ 1 ...

  4. Genotyping by sequencing - Wikipedia

    en.wikipedia.org/wiki/Genotyping_by_sequencing

    In the field of genetic sequencing, genotyping by sequencing, also called GBS, is a method to discover single nucleotide polymorphisms (SNP) in order to perform genotyping studies, such as genome-wide association studies . [1] GBS uses restriction enzymes to reduce genome complexity and genotype multiple DNA samples. [2]

  5. SNP genotyping - Wikipedia

    en.wikipedia.org/wiki/SNP_genotyping

    SNP genotyping is the measurement of genetic variations of single nucleotide polymorphisms (SNPs) between members of a species. It is a form of genotyping, which is the measurement of more general genetic variation. SNPs are one of the most common types of genetic variation.

  6. Gene polymorphism - Wikipedia

    en.wikipedia.org/wiki/Gene_polymorphism

    Polymorphisms can be identified in the laboratory using a variety of methods. Many methods employ PCR to amplify the sequence of a gene. Once amplified, polymorphisms and mutations in the sequence can be detected by DNA sequencing, either directly or after screening for variation with a method such as single strand conformation polymorphism analysis.

  7. Models of DNA evolution - Wikipedia

    en.wikipedia.org/wiki/Models_of_DNA_evolution

    A number of different Markov models of DNA sequence evolution have been proposed. [1] These substitution models differ in terms of the parameters used to describe the rates at which one nucleotide replaces another during evolution. These models are frequently used in molecular phylogenetic analyses.

  8. List of Y-DNA single-nucleotide polymorphisms - Wikipedia

    en.wikipedia.org/wiki/List_of_Y-DNA_single...

    Nucleotide change Position Total size Position Forward 5′→3′ Reverse 5′→3′ M1 (YAP) 291bp insertion M2 A to G: 168 209 aggcactggtcagaatgaag: aatggaaaatacagctcccc: M3 M4 M8 M9 M15 M17 M20 M33 M35 M38 M40 M42 M45 M52 M55 M57 M60 M64.1 M75 M89 M91 M94 M95 M96 M105 M122 M124 M130 M131 M132 M139 M145 M168 M170 M172 M173

  9. Single-strand conformation polymorphism - Wikipedia

    en.wikipedia.org/wiki/Single-strand_conformation...

    A single-strand conformation polymorphism gel where DNA was stained with silver staining. Single-strand conformation polymorphism (SSCP), or single-strand chain polymorphism, is defined as a conformational difference of single-stranded nucleotide sequences of identical length as induced by differences in the sequences under certain experimental conditions.